RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - FRA10AC1

Gene ID	NCBI Gene 118924 \| KEGG hsa:118924
Gene Symbol	FRA10AC1
Protein Name	FRA10A associated CGG repeat 1
Synonyms	C10orf4\|F26C11.1-like\|FRA10A

Ortholog resource in our bank

  FRA10AC1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGY094245	IRAL035K05	pDNR-LIB	BC018007	NM_145246	Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR383698	RBd59E02	pGCAP10	NM_145246.3
HKR383698	GAGAGGCGGGTTGCGGGCGGCGGCGGCGGCGGCGGCGGTGGTGGTTGTGGCGAGGCTGTG
HKR461795	RBdS154I03	pGCAP10	NM_145246.3
HKR461795	GGGCGGCGGCGGCGGCGGTGGTGGTTGTGGCGAGGCTGTGCGGCAGGGCGCACGGGACCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl