Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154I03

Clone ID RBdS154I03
HP ID HP08522
Gene ID 118924
Gene Symbol C10orf4?
Protein Name chromosome 10 open reading frame 4?
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_145246.3
Length of RefSeq (bp) 2400
Chromosome 10q23.33
Reference DDBJ accession
UniGene Hs.658192
5'-terminal sequence GGGCGGCGGCGGCGGCGGTGGTGGTTGTGGCGAGGCTGTGCGGCAGGGCGCACGGGACCT
2011.08.28