Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08474

HP ID(1) HP08474
Gene ID(2)
Gene Symbol finder RABGGTA(exon 1, antisense)
Protein Name
RefSeq
Length of RefSeq (bp)
Chromosome 14q12
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd52G10 pGCAP10 AB593166 GGTGTCCGGAAGCAGCAAGCGTGCCTGGGCAGAGACCCCCAGAGTGTAAAGAGGTCCTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl