Prev. |  Human A to Z list >   >   > 

NRCD Human cDNA Clone - RBd52G10

Catalog Number HKR380954
Clone Name RBd52G10
Clone info. Plasmid clone of human RABGGTA(exon 1, antisense) cDNA with SV40 promoter
Vector plasmidClick for information pGCAP10
5'-terminal sequence(1) GGTGTCCGGAAGCAGCAAGCGTGCCTGGGCAGAGACCCCCAGAGTGTAAAGAGGTCCTGG
Sequence, submitted(2) AB593166 link 01
 
Sequence, refered
HP ID HP08474  finder other clones in this HP group.
Protein Name
Links

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Distribution information

Ordering Information [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR380954 RBd52G10 DNA solution

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference

original Oshikawa, M., Full-length transcriptome analysis of human retina-derived cell lines ARPE-19 and Y79 using the vector-capping method. Invest. Ophthalmol. Vis. Sci. 52 (9): 6662-6670 (2011). PMID 21697133.

2017.04.06

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_170401.pl