Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08473

HP ID(1) HP08473
Gene ID(2) 5930
Gene Symbol finder RBBP6
Protein Name retinoblastoma binding protein 6?
RefSeq NM_006910.4
Length of RefSeq (bp) 6853
Chromosome 16p12.2
Reference DDBJ accession
UniGene Hs.188553

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd52E12 pGCAP10 GGTCCGAAGCCAGGCCGCGTCCGCCATAGTGCCTGGCTTGGAGGTGTCGCCGCCGCTCGG
RBd74A11 pGCAP10 GAGTGCCTGGCTTGGAGGTGTCGCCGCCGCTCGGTGAGAGCCCCCGAGCGGCAGGGGGCC
RBd83C06 pGCAP10 GGCCATAGTGCCTGGCTTGGAGGTGTCGCCGCCGCTCGGTGAGAGCCCCCGAGCGGCAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl