Prev. |  KEGG KO K10624 > 

RIKEN DNA Bank Human Resource - RBBP6

Gene ID NCBI Gene 5930 |  KEGG hsa:5930
Gene Symbol RBBP6
Protein Name RB binding protein 6, ubiquitin ligase
Synonyms MY038|P2P-R|PACT|RBQ-1|SNAMA
Ortholog resources KEGG ortholog (KEGG orthology K10624) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03425 Human RBBP6 cDNA Plasmid clone of human retinoblastoma binding protein 6 (RBBP6) cDNA
RDB03426 pBS-CA-hRBBP6 Expression vector of human retinoblastoma binding protein 6 (RBBP6) cDNA
RDB03427 pCI-hRBBP6 Expression vector of human retinoblastoma binding protein 6 (RBBP6) cDNA
RDB03428 p3XFLAG-hRBBP6 Expression vector of human retinoblastoma binding protein 6 (RBBP6) cDNA

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011010 IRAK027I18 pCMV-SPORT6 BC015318 NM_018703 Partial/var
HGX020976 IRAK052H08 pCMV-SPORT6 BC029649 NM_018703 Partial/var
HGX053747 IRAK134G03 pCMV-SPORT6 BC063524 NM_032626
HGX066670 IRAK166L06 pCMV-SPORT6 BC073938 NM_018703 Partial
HGY096451 IRAL041C03 pDNR-LIB BC030964 NM_018703 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR380908 RBd52E12 pGCAP10 NM_006910.4  
GGTCCGAAGCCAGGCCGCGTCCGCCATAGTGCCTGGCTTGGAGGTGTCGCCGCCGCTCGG
HKR389611 RBd74A11 pGCAP10 NM_006910.4  
GAGTGCCTGGCTTGGAGGTGTCGCCGCCGCTCGGTGAGAGCCCCCGAGCGGCAGGGGGCC
HKR393254 RBd83C06 pGCAP10 NM_006910.4  
GGCCATAGTGCCTGGCTTGGAGGTGTCGCCGCCGCTCGGTGAGAGCCCCCGAGCGGCAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl