DNA Bank Top |  KEGG KO K10624 > 

RIKEN DNA Bank Human Resource - RBBP6

Gene ID NCBI Gene 5930 |  KEGG hsa:5930
Gene Symbol RBBP6
Protein Name RB binding protein 6, ubiquitin ligase
Synonyms MY038|P2P-R|PACT|RBQ-1|SNAMA

Link

Ortholog resource in our bank

  RBBP6

External database

human RBBP6

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB03428 p3XFLAG-hRBBP6 Expression vector of human retinoblastoma binding protein 6 (RBBP6) cDNA    
RDB03427 pCI-hRBBP6 Expression vector of human retinoblastoma binding protein 6 (RBBP6) cDNA    
RDB03426 pBS-CA-hRBBP6 Expression vector of human retinoblastoma binding protein 6 (RBBP6) cDNA    
RDB03425 Human RBBP6 cDNA Plasmid clone of human retinoblastoma binding protein 6 (RBBP6) cDNA    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX066670 IRAK166L06 pCMV-SPORT6 BC073938 NM_018703 Partial
HGX020976 IRAK052H08 pCMV-SPORT6 BC029649 NM_018703 Partial/var
HGX011010 IRAK027I18 pCMV-SPORT6 BC015318 NM_018703 Partial/var
HGX053747 IRAK134G03 pCMV-SPORT6 BC063524 NM_032626
HGY096451 IRAL041C03 pDNR-LIB BC030964 NM_018703 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR380908 RBd52E12 pGCAP10 NM_006910.4  
GGTCCGAAGCCAGGCCGCGTCCGCCATAGTGCCTGGCTTGGAGGTGTCGCCGCCGCTCGG
HKR389611 RBd74A11 pGCAP10 NM_006910.4  
GAGTGCCTGGCTTGGAGGTGTCGCCGCCGCTCGGTGAGAGCCCCCGAGCGGCAGGGGGCC
HKR393254 RBd83C06 pGCAP10 NM_006910.4  
GGCCATAGTGCCTGGCTTGGAGGTGTCGCCGCCGCTCGGTGAGAGCCCCCGAGCGGCAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

♦ No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
♦ A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
♦ Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
♦ Visualization of Organelles update (Dec 18, 2023)
♦ Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
♦ Autophagy and Mitophagy Updates (Aug 16, 2023)
♦ High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
♦ Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
♦ Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
♦ Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
♦ Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.10.02

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl