Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08469

HP ID(1) HP08469
Gene ID(2) 222194
Gene Symbol finder RSBN1L
Protein Name round spermatid basic protein 1-like
RefSeq NM_198467.2
Length of RefSeq (bp) 3220
Chromosome 7q11.23
Reference DDBJ accession
UniGene Hs.592289

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd52C03 pGCAP10 TGCGCAAAATGGCGGAACCGCCGAGCCCCGTGCACTGTGTCGCTGCCGCGGCCCCCACCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl