Prev. | 

RIKEN DNA Bank Human Resource - RSBN1L

Gene ID NCBI Gene 222194 |  KEGG hsa:222194
Gene Symbol RSBN1L
Protein Name round spermatid basic protein 1 like
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX037524 IRAK093N12 pCMV-SPORT6 BC046353 NM_198467 Partial/var
HGY053415 IRAK133I23 pBluescript BC059402 NM_198467

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE121237 M01C103B13 pDONR221 06_12-C07 BC059402 NM_198467  
HGE121285 M01C103D13 pDONR221 06_12-C07 BC059402 NM_198467  
HGE121333 M01C103F13 pDONR221 06_12-C07 BC059402 NM_198467  
HGE121381 M01C103H13 pDONR221 06_12-C07 BC059402 NM_198467  
HGE121429 M01C103J13 pDONR221 06_12-C07 BC059402 NM_198467  
HGE121477 M01C103L13 pDONR221 06_12-C07 BC059402 NM_198467  
HGE121525 M01C103N13 pDONR221 06_12-C07 BC059402 NM_198467  
HGE121573 M01C103P13 pDONR221 06_12-C07 BC059402 NM_198467  
HGE125237 M01C113B13 pDONR221 06-2_05-C07 BC059402 NM_198467  
HGE125285 M01C113D13 pDONR221 06-2_05-C07 BC059402 NM_198467  
HGE125333 M01C113F13 pDONR221 06-2_05-C07 BC059402 NM_198467  
HGE125381 M01C113H13 pDONR221 06-2_05-C07 BC059402 NM_198467  
HGE125429 M01C113J13 pDONR221 06-2_05-C07 BC059402 NM_198467  
HGE125477 M01C113L13 pDONR221 06-2_05-C07 BC059402 NM_198467  
HGE125525 M01C113N13 pDONR221 06-2_05-C07 BC059402 NM_198467  
HGE125573 M01C113P13 pDONR221 06-2_05-C07 BC059402 NM_198467  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR380851 RBd52C03 pGCAP10 NM_198467.2  
TGCGCAAAATGGCGGAACCGCCGAGCCCCGTGCACTGTGTCGCTGCCGCGGCCCCCACCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl