Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08439

HP ID(1) HP08439
Gene ID(2) 25837
Gene Symbol finder RAB26
Protein Name RAB26, member RAS oncogene family
RefSeq NM_014353.4
Length of RefSeq (bp) 1641
Chromosome 16p13.3
Reference DDBJ accession
UniGene Hs.3797

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd47H12 pGCAP10 GGTGGAGCGGCGGGGGCGGGGCGCGAGCCGGGTGCTCGGGATGATGCCGNCGCTGCCGCC
RBd53H10 pGCAP10 GGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCAGGGGAANGNNNNNNNNNNGGGTCGGGCT
RBdS015I15 pGCAP10 GGCCGCCGCCGCCGCCAGGGGAAGGGTTCGGGTCCGGGTCGGGCTCGGCGGGCGCGGGGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl