Prev. |  KEGG KO K07913 > 

RIKEN DNA Bank Human Resource - RAB26

Gene ID NCBI Gene 25837 |  KEGG hsa:25837
Gene Symbol RAB26
Protein Name RAB26, member RAS oncogene family
Synonyms V46133
Featured content Rab Family - human
Ortholog resource in our bank

  RAB26

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY067017 IRAK167J01 pBluescriptR BC066913 NM_014353 Full/var
HGY085090 IRAL012M02 pOTB7 BC007681 NM_014353 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE024723 W01A061N11 pENTR-TOPO IRAK167J01 BC066913 NM_014353  
HGE024725 W01A061N13 pENTR-TOPO IRAK167J01 BC066913 NM_014353  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR378980 RBd47H12 pGCAP10 NM_014353.4  
GGTGGAGCGGCGGGGGCGGGGCGCGAGCCGGGTGCTCGGGATGATGCCGNCGCTGCCGCC
HKR381378 RBd53H10 pGCAP10 NM_014353.4  
GGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCAGGGGAANGNNNNNNNNNNGGGTCGGGCT
HKR406207 RBdS015I15 pGCAP10 NM_014353.4  
GGCCGCCGCCGCCGCCAGGGGAAGGGTTCGGGTCCGGGTCGGGCTCGGCGGGCGCGGGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl