Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08293

HP ID(1) HP08293
Gene ID(2) 3516
Gene Symbol finder RBPJ
Protein Name recombination signal binding protein for immunoglobulin kappa J region
RefSeq NM_015874.3
Length of RefSeq (bp) 2316
Chromosome 4p15.2
Reference DDBJ accession
UniGene Hs.479396

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd94H06 pGCAP10 GATCGCCTGGGTAGGTTTCCAGGGAAGGCAGCGAGCAGGATCCCCTACTCTGCGGGCGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl