Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RBPJ

Gene ID (NCBI) 3516
Gene Symbol RBPJ
Protein Name recombination signal binding protein for immunoglobulin kappa J region
Synonyms AOS3|CBF1|IGKJRB|IGKJRB1|KBF2|RBP-J|RBPJK|RBPSUH|SUH|csl
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Notch signaling pathway (human)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03782 SEREX clone NGO-St-001 (ID 8) #2 SEREX clone NGO-St-001 (ID 8) #2; RBPJ
RDB03799 SEREX clone NGO-St-001 (ID 8) #1 SEREX clone NGO-St-001 (ID 8) #1
RDB03895 SEREX clone NGO-St-115 #1 SEREX clone NGO-St-115 #1
RDB04466 SEREX clone BRC-Co-5 #1 SEREX clone BRC-Co-5 #1
RDB06712 pET_hsRBPSUH Prokaryotic expression vector of human RBPJ

RDB_hum_160722.csv


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX046011 IRAK115A11 pCMV-SPORT6 BC053531 NM_203284 Partial
HGX056262 IRAK140K22 pCMV-SPORT6 BC064976 NM_203284 Full
HGY094916 IRAL037E20 pDNR-LIB BC020780 NM_203283 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE036901 W01A092E05 pENTR-TOPO IRAL037E20 BC020780 NM_203283  
HGE036903 W01A092E07 pENTR-TOPO IRAL037E20 BC020780 NM_203283 done
HGE036909 W01A092E13 pENTR-TOPO IRAL037E20 BC020780 NM_203283  
HGE036913 W01A092E17 pENTR-TOPO IRAL037E20 BC020780 NM_203283  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR397774 RBd94H06 pGCAP10 NM_015874.3  
GATCGCCTGGGTAGGTTTCCAGGGAAGGCAGCGAGCAGGATCCCCTACTCTGCGGGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.13

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl