Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08207

HP ID(1) HP08207
Gene ID(2) 80010
Gene Symbol finder RMI1
Protein Name RMI1, RecQ mediated genome instability 1, homolog (S. cerevisiae)
RefSeq NM_024945.2
Length of RefSeq (bp) 3508
Chromosome 9q21.32
Reference DDBJ accession
UniGene Hs.284137

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS191M01 pGCAP10 GGGCAAATCGGGCGGGAAGAGGTAAAAAAGGAACTGGGAGCGAGCCGCGGCGGTTCCTGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl