Prev. |  KEGG KO K10990 > 

RIKEN DNA Bank Human Resource - RMI1

Gene ID NCBI Gene 80010 |  KEGG hsa:80010
Gene Symbol RMI1
Protein Name RecQ mediated genome instability 1
Synonyms BLAP75|C9orf76|FAAP75
Ortholog resource in our bank

  RMI1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033764 IRAK084G20 pCMV-SPORT6 BC039999 NM_024945 Full/var
HGX046213 IRAK115I21 pCMV-SPORT6 BC053549 NM_024945 Partial/var
HGX056291 IRAK140M03 pCMV-SPORT6 BC064937 NM_024945 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR276689 ARiS191M01 pGCAP10 NM_024945.2  
GGGCAAATCGGGCGGGAAGAGGTAAAAAAGGAACTGGGAGCGAGCCGCGGCGGTTCCTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl