Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08122

HP ID(1) HP08122
Gene ID(2) 123720
Gene Symbol finder WHDC1
Protein Name WAS protein homology region 2 domain containing 1
RefSeq NM_001080435.1
Length of RefSeq (bp) 4261
Chromosome 15q25.2
Reference DDBJ accession
UniGene Hs.377360

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS122O22 pGCAP10 GGCTGCTGCCGACAGCCATGGAGGACGAGCAGCCTGACAGCCTGGAGGGCTGGGTGCCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl