ARiS122O22 - NRCD Human cDNA Clone

Catalog Number HKR249158 Clone Name ARiS122O22 Clone info. Plasmid clone of human WHDC1 cDNA with SV40 promoter Vector(1) pGCAP10 5'-terminal sequence(2) GGCTGCTGCCGACAGCCATGGAGGACGAGCAGCCTGACAGCCTGGAGGGCTGGGTGCCGG Sequence, submitted(3) n.a. Note Suspected to be a genomic DNA clone.   Sequence, refered NM_001080435.1 (NCBI RefSeq mRNA) Gene Symbol and ID(4) WHAMM (NCBI Gene 123720)  other clone of WHAMM in our bank Synonyms WHAMM1|WHDC1 Protein Name WASP homolog associated with actin, golgi membranes and microtubules

Links   KEGG   NCBI Gene   NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

How to cite this biological resource

Materials & Methods section:

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

References and tips

Featured content

Reference

2023.07.07