Prev. |  KEGG KO K20479 > 

RIKEN DNA Bank Human Resource - WHAMM

Gene ID NCBI Gene 123720 |  KEGG hsa:123720
Gene Symbol WHAMM
Protein Name WASP homolog associated with actin, golgi membranes and microtubules
Synonyms WHAMM1|WHDC1
Ortholog resources KEGG ortholog (KEGG orthology K20479) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE105603 M01C064A03 pDONR221 06_06-E02 AK126887 XM_058720  
HGE105651 M01C064C03 pDONR221 06_06-E02 AK126887 XM_058720  
HGE105699 M01C064E03 pDONR221 06_06-E02 AK126887 XM_058720  
HGE105747 M01C064G03 pDONR221 06_06-E02 AK126887 XM_058720  
HGE105795 M01C064I03 pDONR221 06_06-E02 AK126887 XM_058720  
HGE105843 M01C064K03 pDONR221 06_06-E02 AK126887 XM_058720  
HGE105891 M01C064M03 pDONR221 06_06-E02 AK126887 XM_058720  
HGE105939 M01C064O03 pDONR221 06_06-E02 AK126887 XM_058720  
HGE105605 M01C064A05 pDONR221 06_06-E03 AK126887 XM_058720  
HGE105653 M01C064C05 pDONR221 06_06-E03 AK126887 XM_058720  
HGE105701 M01C064E05 pDONR221 06_06-E03 AK126887 XM_058720  
HGE105749 M01C064G05 pDONR221 06_06-E03 AK126887 XM_058720  
HGE105797 M01C064I05 pDONR221 06_06-E03 AK126887 XM_058720  
HGE105845 M01C064K05 pDONR221 06_06-E03 AK126887 XM_058720  
HGE105893 M01C064M05 pDONR221 06_06-E03 AK126887 XM_058720  
HGE105941 M01C064O05 pDONR221 06_06-E03 AK126887 XM_058720  
HGE124413 M01C111A13 pDONR221 06-2_04-A07 AK126887 XM_058720  
HGE124461 M01C111C13 pDONR221 06-2_04-A07 AK126887 XM_058720  
HGE124509 M01C111E13 pDONR221 06-2_04-A07 AK126887 XM_058720  
HGE124557 M01C111G13 pDONR221 06-2_04-A07 AK126887 XM_058720  
HGE124605 M01C111I13 pDONR221 06-2_04-A07 AK126887 XM_058720  
HGE124653 M01C111K13 pDONR221 06-2_04-A07 AK126887 XM_058720  
HGE124701 M01C111M13 pDONR221 06-2_04-A07 AK126887 XM_058720  
HGE124749 M01C111O13 pDONR221 06-2_04-A07 AK126887 XM_058720  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR249158 ARiS122O22 pGCAP10 NM_001080435.1 done
GGCTGCTGCCGACAGCCATGGAGGACGAGCAGCCTGACAGCCTGGAGGGCTGGGTGCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl