Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08016

HP ID(1) HP08016
Gene ID(2) 349667
Gene Symbol finder RTN4RL2
Protein Name reticulon 4 receptor-like 2
RefSeq NM_178570.1
Length of RefSeq (bp) 1263
Chromosome 11q12.1
Reference DDBJ accession
UniGene Hs.502618

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS088D07 pGCAP10 GCTCTCGGCTAGCAGCCTGGGCACACGGACAGACGGACTGACGGACTCTCGAGCGGACAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl