RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - RTN4RL2

Gene ID	NCBI Gene 349667 \| KEGG hsa:349667
Gene Symbol	RTN4RL2
Protein Name	reticulon 4 receptor like 2
Synonyms	NGRH1\|NgR2

Ortholog resource in our bank

  RTN4RL2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR235279	ARiS088D07	pGCAP10	NM_178570.1
HKR235279	GCTCTCGGCTAGCAGCCTGGGCACACGGACAGACGGACTGACGGACTCTCGAGCGGACAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl