Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RTN4RL2

Gene ID (NCBI) 349667
Gene Symbol RTN4RL2
Protein Name reticulon 4 receptor like 2
Synonyms NGRH1|NgR2
Databases KEGG hsa:349667 |  NCBI Gene 349667
Featured content Ortholog resources in the DNA Bank (KEGG orthology K16661)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR235279 ARiS088D07 pGCAP10 NM_178570.1  
GCTCTCGGCTAGCAGCCTGGGCACACGGACAGACGGACTGACGGACTCTCGAGCGGACAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl