Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07905

HP ID(1) HP07905
Gene ID(2) 83546
Gene Symbol finder RTBDN
Protein Name retbindin
RefSeq NM_031429.1
Length of RefSeq (bp) 1355
Chromosome 19p12
Reference DDBJ accession
UniGene Hs.21162

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd44B08 pGCAP10 AB593122 GGTAGTGGAGGAGGTGGAATGAAGAGTGAGAAAGCTGTCTAGGTGCCTGTCCAATTAGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl