Prev. | 

RIKEN DNA Bank Human Resource - RTBDN

Gene ID NCBI Gene 83546 |  KEGG hsa:83546
Gene Symbol RTBDN
Protein Name retbindin
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087258 IRAL018C10 pOTB7 BC005063 NM_031429

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098812 M01C047A12 pDONR221 MGC13-B06 BC005063 NM_031429  
HGE098860 M01C047C12 pDONR221 MGC13-B06 BC005063 NM_031429  
HGE098908 M01C047E12 pDONR221 MGC13-B06 BC005063 NM_031429  
HGE098956 M01C047G12 pDONR221 MGC13-B06 BC005063 NM_031429  
HGE099004 M01C047I12 pDONR221 MGC13-B06 BC005063 NM_031429  
HGE099052 M01C047K12 pDONR221 MGC13-B06 BC005063 NM_031429  
HGE099100 M01C047M12 pDONR221 MGC13-B06 BC005063 NM_031429  
HGE099148 M01C047O12 pDONR221 MGC13-B06 BC005063 NM_031429  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR377632 RBd44B08 pGCAP10 NM_001270441.2 full cds  
GGTAGTGGAGGAGGTGGAATGAAGAGTGAGAAAGCTGTCTAGGTGCCTGTCCAATTAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl