Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07892

HP ID(1) HP07892
Gene ID(2) 8731
Gene Symbol finder RNMT
Protein Name RNA (guanine-7-) methyltransferase
RefSeq NM_003799.1
Length of RefSeq (bp) 6203
Chromosome 18p11.22-p11.23
Reference DDBJ accession
UniGene Hs.592347

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd44G06 pGCAP10 GAGACTGGGCGAGCCCGGGTGGGAGAAGCAGCTCGAAGAGCTGCTCCAGCTCGCGCCCCA
RBdS070H20 pGCAP10 GGCCGTTTCCGCAAACAGAATCGCGTTTGGCTGTGCTGGATGTGTGAACCTATTGGGTAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl