Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS070H20

Clone ID RBdS070H20
HP ID HP07892
Gene ID 8731
Gene Symbol RNMT
Protein Name RNA (guanine-7-) methyltransferase
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_003799.1
Length of RefSeq (bp) 6203
Chromosome 18p11.22-p11.23
Reference DDBJ accession
UniGene Hs.592347
5'-terminal sequence GGCCGTTTCCGCAAACAGAATCGCGTTTGGCTGTGCTGGATGTGTGAACCTATTGGGTAC
2011.08.28