Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07885

HP ID(1) HP07885
Gene ID(2) 80335
Gene Symbol finder WDR82
Protein Name WD repeat domain 82
RefSeq NM_025222.3
Length of RefSeq (bp) 4292
Chromosome 3p21.1
Reference DDBJ accession
UniGene Hs.194110

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd42C11 pGCAP10 GAAAATGGCGGACACAATGAGCCGGCGACGCGCCGGTTGTCCGTGAGGTGGCTGTGAGGA
RBdS040O18 pGCAP10 AGCTTCTGCCTGTCGCCCCAAAATGGCGGACACAATGAGCCGGCGACGCGCCGGTTGTCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl