Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS040O18

Clone ID RBdS040O18
HP ID HP07885
Gene ID 80335
Gene Symbol WDR82
Protein Name WD repeat domain 82
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_025222.3
Length of RefSeq (bp) 4292
Chromosome 3p21.1
Reference DDBJ accession
UniGene Hs.194110
5'-terminal sequence AGCTTCTGCCTGTCGCCCCAAAATGGCGGACACAATGAGCCGGCGACGCGCCGGTTGTCC
2011.08.28