Prev. |  KEGG KO K14962 > 

RIKEN DNA Bank Human Resource - WDR82

Gene ID NCBI Gene 80335 |  KEGG hsa:80335
Gene Symbol WDR82
Protein Name WD repeat domain 82
Synonyms MST107|MSTP107|PRO2730|PRO34047|SWD2|TMEM113|WDR82A
Ortholog resource in our bank

  WDR82

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088190 IRAL020H22 pOTB7 BC018941 NM_025222 Full
HGY090922 IRAL027F02 pOTB7 BC011760 NM_025222 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE123210 M01C108A10 pDONR221 06_14-F05 AK123860 NM_025222  
HGE123402 M01C108I10 pDONR221 06_14-F05 AK123860 NM_025222  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR376859 RBd42C11 pGCAP10 NM_025222.3  
GAAAATGGCGGACACAATGAGCCGGCGACGCGCCGGTTGTCCGTGAGGTGGCTGTGAGGA
HKR416354 RBdS040O18 pGCAP10 NM_025222.3  
AGCTTCTGCCTGTCGCCCCAAAATGGCGGACACAATGAGCCGGCGACGCGCCGGTTGTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl