Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07814

HP ID(1) HP07814
Gene ID(2) 5335
Gene Symbol finder PLCG1
Protein Name phospholipase C, gamma 1
RefSeq NM_002660.2
Length of RefSeq (bp) 5205
Chromosome 20q12-q13.1
Reference DDBJ accession
UniGene Hs.268177

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd35D12 pGCAP10 GGAGGGCGCGCGGAGGACCCGCCGCCGCCGGTGTGAGGCGGCCCGTCCTGGCTCCCTTGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl