Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07785

HP ID(1) HP07785
Gene ID(2) 146206
Gene Symbol finder RLTPR
Protein Name RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing
RefSeq NM_001013838.1
Length of RefSeq (bp) 4512
Chromosome 16q22.1
Reference DDBJ accession
UniGene Hs.611432

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd31H07 pGCAP10 TGGGGGGTGGGGTGGGGGACACTGCAGGGAACTGTTCGGAGCAGAGCTGGTGGTACCCCC
RBd48D06 pGCAP10 GTCTTCTGGTGCTGTCCCCTCAGGTGCTGCTGAGGGAGCGGAGCCGGAGCCCGAGCTGGC
RBd49C08 pGCAP10 TGGGGCTCGGCGCTCGGTGCTCTTCTGGTGCTGTCCCCTCAGGTGCTGCTGAGGAAGCGG
RBdS154O03 pGCAP10 GGCTCGGCGCTCGGTGCTCTTCTGGTGCTGTCCCCTCAGGTGCTGCTGAGGAAGCGGAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl