Prev. |  KEGG KO K20493 > 

RIKEN DNA Bank Human Resource - CARMIL2

Gene ID NCBI Gene 146206 |  KEGG hsa:146206
Gene Symbol CARMIL2
Protein Name capping protein regulator and myosin 1 linker 2
Synonyms CARMIL2b|IMD58|LRRC16C|RLTPR
Ortholog resources KEGG ortholog (KEGG orthology K20493) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY030145 IRAK075G01 pBluescriptR BC043154 NM_001013838 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR372575 RBd31H07 pGCAP10 NM_001013838.1  
TGGGGGGTGGGGTGGGGGACACTGCAGGGAACTGTTCGGAGCAGAGCTGGTGGTACCCCC
HKR379278 RBd48D06 pGCAP10 NM_001013838.1  
GTCTTCTGGTGCTGTCCCCTCAGGTGCTGCTGAGGGAGCGGAGCCGGAGCCCGAGCTGGC
HKR379656 RBd49C08 pGCAP10 NM_001013838.1  
TGGGGCTCGGCGCTCGGTGCTCTTCTGGTGCTGTCCCCTCAGGTGCTGCTGAGGAAGCGG
HKR461939 RBdS154O03 pGCAP10 NM_001013838.1  
GGCTCGGCGCTCGGTGCTCTTCTGGTGCTGTCCCCTCAGGTGCTGCTGAGGAAGCGGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl