Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07750

HP ID(1) HP07750
Gene ID(2) 6015
Gene Symbol finder RING1
Protein Name ring finger protein 1
RefSeq NM_002931.3
Length of RefSeq (bp) 1744
Chromosome 6p21.3
Reference DDBJ accession
UniGene Hs.631989

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi39B04 pGCAP10 GAGGGCCCCAGCGCCCGGGCCATGGCGGCGGCGGTGGCGGGAGCTGCTGTCTGAGCAGCG
RBdS104N19 pGCAP10 GAGGGCCCCAGCGCCCGGGCCATGGCGGCGGCGGTGGCGGGAGCTGCTGTCTGAGCAGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl