Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS104N19

Clone ID RBdS104N19
HP ID HP07750
Gene ID 6015
Gene Symbol RING1
Protein Name ring finger protein 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002931.3
Length of RefSeq (bp) 1744
Chromosome 6p21.3
Reference DDBJ accession
UniGene Hs.631989
5'-terminal sequence GAGGGCCCCAGCGCCCGGGCCATGGCGGCGGCGGTGGCGGGAGCTGCTGTCTGAGCAGCG
2011.08.28