Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07688

HP ID(1) HP07688
Gene ID(2) 5959
Gene Symbol finder RDH5
Protein Name retinol dehydrogenase 5 (11-cis/9-cis)
RefSeq NM_002905.3
Length of RefSeq (bp) 1354
Chromosome 12q13.2
Reference DDBJ accession
UniGene Hs.600940

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi71D05 pGCAP10 GAGTGTGGGAGGCTGGGAAGACTGGGAGCAGTCTCTTAAACAAAAGCAAAAGAATAAGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl