Prev. |  KEGG KO K00061 > 

RIKEN DNA Bank Human Resource - RDH5

Gene ID NCBI Gene 5959 |  KEGG hsa:5959
Gene Symbol RDH5
Protein Name retinol dehydrogenase 5
Synonyms 9cRDH|HSD17B9|RDH1|SDR9C5
Ortholog resource in our bank

  RDH5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011974 IRAK029P14 pCMV-SPORT6 BC028298 NM_002905 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092810 M01C032A10 pDONR221 MGC05-F05 BC028298 NM_002905  
HGE092858 M01C032C10 pDONR221 MGC05-F05 BC028298 NM_002905  
HGE092906 M01C032E10 pDONR221 MGC05-F05 BC028298 NM_002905  
HGE092954 M01C032G10 pDONR221 MGC05-F05 BC028298 NM_002905  
HGE093002 M01C032I10 pDONR221 MGC05-F05 BC028298 NM_002905  
HGE093050 M01C032K10 pDONR221 MGC05-F05 BC028298 NM_002905  
HGE093098 M01C032M10 pDONR221 MGC05-F05 BC028298 NM_002905  
HGE093146 M01C032O10 pDONR221 MGC05-F05 BC028298 NM_002905  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE014509 W01A036E13 pENTR-TOPO IRAK029P14 BC028298 NM_002905  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR188477 ARi71D05 pGCAP10 NM_002905.3  
GAGTGTGGGAGGCTGGGAAGACTGGGAGCAGTCTCTTAAACAAAAGCAAAAGAATAAGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl