Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07607

HP ID(1) HP07607
Gene ID(2) 11031
Gene Symbol finder RAB31
Protein Name RAB31, member RAS oncogene family
RefSeq NM_006868.3
Length of RefSeq (bp) 4009
Chromosome 18p11.3
Reference DDBJ accession
UniGene Hs.99528

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi55H05 pGCAP10 GGGTTCCGCCCGCGGGCGGCGCGAGCGAGGGGCAGAGGCGAGAGACGCCGGCGGGGCGCG
ARiS085L11 pGCAP10 GGGGCGGCGCGAGCGAGGGGCAGAGGCGAGAGACGCCGGCGGGGCGCGGGCGCGGCGGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl