Prev. |  KEGG KO K07891 > 

RIKEN DNA Bank Human Resource - RAB31

Gene ID NCBI Gene 11031 |  KEGG hsa:11031
Gene Symbol RAB31
Protein Name RAB31, member RAS oncogene family
Synonyms Rab22B
Featured content Endocytosis (human)
Featured content Rab Family - human
Ortholog resource in our bank

  RAB31

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083411 IRAL008I19 pOTB7 BC001148 NM_006868 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR182173 ARi55H05 pGCAP10 NM_006868.3  
GGGTTCCGCCCGCGGGCGGCGCGAGCGAGGGGCAGAGGCGAGAGACGCCGGCGGGGCGCG
HKR234275 ARiS085L11 pGCAP10 NM_006868.3  
GGGGCGGCGCGAGCGAGGGGCAGAGGCGAGAGACGCCGGCGGGGCGCGGGCGCGGCGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl