Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07529

HP ID(1) HP07529
Gene ID(2) 9686
Gene Symbol finder VGLL4
Protein Name vestigial like 4 (Drosophila)
RefSeq NM_014667.2
Length of RefSeq (bp) 3275
Chromosome 3p25.2
Reference DDBJ accession
UniGene Hs.38032

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi43F04 pGCAP10 GGTCCCCGCCCCTGGGTCCCCCGCAGGGCCAGGCCGGCCCCAGGCGGGCGCGCCCAGAGC
ARiS198F02 pGCAP10 GAGGCCGGCCCCAGGCGGGCGCGCCCAGAGCCGCCGGGCGGAACACCTGGCAGTTTGAAT
RBd81F11 pGCAP10 GATGCCAAGCATAGCCCTCATGTCAGCGCTGCCGGCTTGCAGCGGGCTGTGAGAGGGGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl