Prev. | 

RIKEN DNA Bank Human Resource - VGLL4

Gene ID NCBI Gene 9686 |  KEGG hsa:9686
Gene Symbol VGLL4
Protein Name vestigial like family member 4
Synonyms VGL-4
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081075 IRAL002L11 pOTB7 BC000763 NM_014667 Full/var
HGY081123 IRAL002N11 pOTB7 BC001514 NM_014667 Full
HGY083700 IRAL009E04 pOTB7 BC003038 NM_014667 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE085641 M01C014B17 pDONR221 FLJ04-G09 AK130542 ENST00000273038  
HGE085689 M01C014D17 pDONR221 FLJ04-G09 AK130542 ENST00000273038  
HGE085737 M01C014F17 pDONR221 FLJ04-G09 AK130542 ENST00000273038  
HGE085785 M01C014H17 pDONR221 FLJ04-G09 AK130542 ENST00000273038  
HGE085833 M01C014J17 pDONR221 FLJ04-G09 AK130542 ENST00000273038  
HGE085881 M01C014L17 pDONR221 FLJ04-G09 AK130542 ENST00000273038  
HGE085929 M01C014N17 pDONR221 FLJ04-G09 AK130542 ENST00000273038  
HGE085977 M01C014P17 pDONR221 FLJ04-G09 AK130542 ENST00000273038  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE038474 W01A096D02 pENTR-TOPO flj0055n16 AK130542 NM_014667  
HGE038476 W01A096D04 pENTR-TOPO flj0055n16 AK130542 NM_014667  
HGE038478 W01A096D06 pENTR-TOPO flj0055n16 AK130542 NM_014667  
HGE038482 W01A096D10 pENTR-TOPO flj0055n16 AK130542 NM_014667  
HGE048299 W01A120M11 pENTR-TOPO flj0055n16 AK130542 NM_014667  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR177324 ARi43F04 pGCAP10 NM_014667.2  
GGTCCCCGCCCCTGGGTCCCCCGCAGGGCCAGGCCGGCCCCAGGCGGGCGCGCCCAGAGC
HKR279322 ARiS198F02 pGCAP10 NM_014667.2  
GAGGCCGGCCCCAGGCGGGCGCGCCCAGAGCCGCCGGGCGGAACACCTGGCAGTTTGAAT
HKR392531 RBd81F11 pGCAP10 NM_014667.2  
GATGCCAAGCATAGCCCTCATGTCAGCGCTGCCGGCTTGCAGCGGGCTGTGAGAGGGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl