Prev. | NRCD Clone X | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07522

HP ID(1) HP07522
Gene ID(2) 7514
Gene Symbol finder XPO1
Protein Name exportin 1 (CRM1 homolog, yeast)
RefSeq NM_003400.3
Length of RefSeq (bp) 4830
Chromosome 2p16
Reference DDBJ accession
UniGene Hs.370770

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi42F08 pGCAP10 GGCCCAGGTTCCAAACGCTCCGCGGCGCCATGGGCTGAAAACTCAACCGAGATGGAATCT
ARiS118E11 pGCAP10 GGCCCNNGTTCNNAACGCNCCNCGGNGCCATGGGCTGAAAACTCAACCGAGATGGAATCT
RBd98E01 pGCAP10 GGCCATGGGCTGAAAACTCAACCGAGATGGAATCTCCCAGTCTGAACCGGTTTCAACCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl