Prev. |  KEGG KO K14290 > 

RIKEN DNA Bank Human Resource - XPO1

Gene ID NCBI Gene 7514 |  KEGG hsa:7514
Gene Symbol XPO1
Protein Name exportin 1
Synonyms CRM-1|CRM1|emb|exp1
Featured content Influenza A relevant genes - human
Ortholog resource in our bank

  XPO1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY019080 IRAK047L16 pBluescriptR BC032847 NM_003400 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR176928 ARi42F08 pGCAP10 NM_003400.3  
GGCCCAGGTTCCAAACGCTCCGCGGCGCCATGGGCTGAAAACTCAACCGAGATGGAATCT
HKR247307 ARiS118E11 pGCAP10 NM_003400.3  
GGCCCNNGTTCNNAACGCNCCNCGGNGCCATGGGCTGAAAACTCAACCGAGATGGAATCT
HKR399297 RBd98E01 pGCAP10 NM_003400.3  
GGCCATGGGCTGAAAACTCAACCGAGATGGAATCTCCCAGTCTGAACCGGTTTCAACCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl