Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07518

HP ID(1) HP07518
Gene ID(2) 80219
Gene Symbol finder COQ10B
Protein Name coenzyme Q10 homolog B (S. cerevisiae)
RefSeq NM_025147.3
Length of RefSeq (bp) 1989
Chromosome 2q33.1
Reference DDBJ accession
UniGene Hs.715692

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi41H12 pGCAP10 GGAGTCTATCATGGCAGCTCGGACTGGTCATACGGCCTTGAGAAGGGTAGTCTCGGGATG
RBdS022O21 pGCAP10 GAGGTGACGACCGGCTTCGGAGAGTCTATCATGGCAGCTCGGACTGGTCATACGGCCTTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl