Prev. |  KEGG KO K18588 > 

RIKEN DNA Bank Human Resource - COQ10B

Gene ID NCBI Gene 80219 |  KEGG hsa:80219
Gene Symbol COQ10B
Protein Name coenzyme Q10B
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K18588) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY012940 IRAK032F20 pBluescriptR BC022453 NM_025147 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR176580 ARi41H12 pGCAP10 NM_025147.3  
GGAGTCTATCATGGCAGCTCGGACTGGTCATACGGCCTTGAGAAGGGTAGTCTCGGGATG
HKR409157 RBdS022O21 pGCAP10 NM_025147.3  
GAGGTGACGACCGGCTTCGGAGAGTCTATCATGGCAGCTCGGACTGGTCATACGGCCTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl