Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022O21

Clone ID RBdS022O21
HP ID HP07518
Gene ID 80219
Gene Symbol COQ10B
Protein Name coenzyme Q10 homolog B (S. cerevisiae)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_025147.3
Length of RefSeq (bp) 1989
Chromosome 2q33.1
Reference DDBJ accession
UniGene Hs.715692
5'-terminal sequence GAGGTGACGACCGGCTTCGGAGAGTCTATCATGGCAGCTCGGACTGGTCATACGGCCTTG
2011.08.28