Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07458

HP ID(1) HP07458
Gene ID(2) 83937
Gene Symbol finder RASSF4
Protein Name Ras association (RalGDS/AF-6) domain family 4
RefSeq NM_032023.3
Length of RefSeq (bp) 2509
Chromosome 10q11.21
Reference DDBJ accession
UniGene Hs.522895

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS023B10 pGCAP10 GCCTGAGGGGATGGGGCCACTCAGGAGGAGGGATGTGCAAGGCCTGAGTGTTCAGAGCAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl