Prev. |  KEGG KO K09851 > 

RIKEN DNA Bank Human Resource - RASSF4

Gene ID NCBI Gene 83937 |  KEGG hsa:83937
Gene Symbol RASSF4
Protein Name Ras association domain family member 4
Synonyms AD037
Ortholog resource in our bank

  RASSF4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027804 IRAK069I12 pCMV-SPORT6 BC032593 NM_032023 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE094020 M01C035A20 pDONR221 MGC07-B10 BC032593 NM_032023  
HGE094068 M01C035C20 pDONR221 MGC07-B10 BC032593 NM_032023  
HGE094116 M01C035E20 pDONR221 MGC07-B10 BC032593 NM_032023  
HGE094164 M01C035G20 pDONR221 MGC07-B10 BC032593 NM_032023  
HGE094212 M01C035I20 pDONR221 MGC07-B10 BC032593 NM_032023  
HGE094260 M01C035K20 pDONR221 MGC07-B10 BC032593 NM_032023  
HGE094308 M01C035M20 pDONR221 MGC07-B10 BC032593 NM_032023  
HGE094356 M01C035O20 pDONR221 MGC07-B10 BC032593 NM_032023  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR209234 ARiS023B10 pGCAP10 NM_032023.3  
GCCTGAGGGGATGGGGCCACTCAGGAGGAGGGATGTGCAAGGCCTGAGTGTTCAGAGCAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl