Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07427

HP ID(1) HP07427
Gene ID(2) 9821
Gene Symbol finder RB1CC1
Protein Name RB1-inducible coiled-coil 1
RefSeq NM_014781.4
Length of RefSeq (bp) 6670
Chromosome 8q11.23
Reference DDBJ accession
UniGene Hs.196102

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS109H13 pGCAP10 GGTTTCCCGGCATGCGCCGCGGAGGAAGAGACGGAGTCGACAATAACAAACCAAGCCGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl