DNA Bank Top |  KEGG KO K17589 > 

RIKEN DNA Bank Human Resource - RB1CC1

Gene ID NCBI Gene 9821 |  KEGG hsa:9821
Gene Symbol RB1CC1
Protein Name RB1 inducible coiled-coil 1
Synonyms ATG17|CC1|FIP200|PPP1R131
Featured content Autophagy (human)

Link

Ortholog resource in our bank

  RB1CC1


External database

human RB1CC1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB19769 pME18s-HA-hFIP200 Expression vector of human FIP200 with N-terminal HA.    
RDB19762 p3xFLAG-CMV10-hFIP200 Transient expression vector of human FIP200 with N-terminal 3×FLAG.    
RDB19623 pMXs-IP-EGFP-hFIP200 Retroviral vector for stable expression of human FIP200 with N-terminal EGFP.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006066 IRAK015C18 pCMV-SPORT6 BC017556 NM_014781 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092024 M01C030A24 pDONR221 MGC04-F12 BC017556 ENST00000025008  
HGE092072 M01C030C24 pDONR221 MGC04-F12 BC017556 ENST00000025008  
HGE092120 M01C030E24 pDONR221 MGC04-F12 BC017556 ENST00000025008  
HGE092168 M01C030G24 pDONR221 MGC04-F12 BC017556 ENST00000025008  
HGE092216 M01C030I24 pDONR221 MGC04-F12 BC017556 ENST00000025008  
HGE092264 M01C030K24 pDONR221 MGC04-F12 BC017556 ENST00000025008  
HGE092312 M01C030M24 pDONR221 MGC04-F12 BC017556 ENST00000025008  
HGE092360 M01C030O24 pDONR221 MGC04-F12 BC017556 ENST00000025008  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR243781 ARiS109H13 pGCAP10 NM_014781.4  
GGTTTCCCGGCATGCGCCGCGGAGGAAGAGACGGAGTCGACAATAACAAACCAAGCCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.10.04

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl