Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07413

HP ID(1) HP07413
Gene ID(2) 23180
Gene Symbol finder RFTN1
Protein Name raftlin, lipid raft linker 1
RefSeq NM_015150.1
Length of RefSeq (bp) 3033
Chromosome p24.3
Reference DDBJ accession
UniGene Hs.98910

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi29G10 pGCAP10 GGAGGAAGTGTAGCCGGCGGACGCGCGGCGGCGGCGGCGGGGGCGCGTCGGGGCTGGAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl