Prev. | 

RIKEN DNA Bank Human Resource - RFTN1

Gene ID NCBI Gene 23180 |  KEGG hsa:23180
Gene Symbol RFTN1
Protein Name raftlin, lipid raft linker 1
Synonyms MIG2|PIB10|PIG9|RAFTLIN
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025862 IRAK064K22 pCMV-SPORT6 BC032349 NM_015150 Partial/var
HGY087167 IRAL017P07 pOTB7 BC006400 NM_015150 Partial/var
HGY091523 IRAL028N11 pOTB7 BC014032 NM_015150 Partial/var
HGY099046 IRAL047K06 pOTB7 BC051336 NM_015150 Full/var
HGY101725 IRAL054F05 pOTB7 BC069209 NM_015150 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE126815 M01C117A15 pDONR221 3_5-A08 AK074446 NM_015150  
HGE085220 M01C013A20 pDONR221 FLJ04-B10 AK074446 NM_015150  
HGE085268 M01C013C20 pDONR221 FLJ04-B10 AK074446 NM_015150  
HGE085316 M01C013E20 pDONR221 FLJ04-B10 AK074446 NM_015150  
HGE085364 M01C013G20 pDONR221 FLJ04-B10 AK074446 NM_015150  
HGE085412 M01C013I20 pDONR221 FLJ04-B10 AK074446 NM_015150  
HGE085460 M01C013K20 pDONR221 FLJ04-B10 AK074446 NM_015150  
HGE085508 M01C013M20 pDONR221 FLJ04-B10 AK074446 NM_015150  
HGE085556 M01C013O20 pDONR221 FLJ04-B10 AK074446 NM_015150  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR171754 ARi29G10 pGCAP10 NM_015150.1  
GGAGGAAGTGTAGCCGGCGGACGCGCGGCGGCGGCGGCGGGGGCGCGTCGGGGCTGGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl