Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07321

HP ID(1) HP07321
Gene ID(2) 5917
Gene Symbol finder RARS
Protein Name arginyl-tRNA synthetase
RefSeq NM_002887.3
Length of RefSeq (bp) 2154
Chromosome 5q35.1
Reference DDBJ accession
UniGene Hs.654907

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS013K06 pGCAP10 GACTTGGCGAGTGAGACGCTGATGGGAGGATGGACATACTGGTGTCTGAGTGCTCCGCGC
ARiS198H24 pGCAP10 NCCGNNNNCNCNCGGGCNCNNTNCGNNNCGCCCNNCGGCGAGNGAGNCGCNGANGGGAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl