Prev. |  KEGG KO K01887 > 

RIKEN DNA Bank Human Resource - RARS1

Gene ID NCBI Gene 5917 |  KEGG hsa:5917
Gene Symbol RARS1
Protein Name arginyl-tRNA synthetase 1
Synonyms ArgRS|DALRD1|HLD9|RARS
Ortholog resource in our bank

  RARS1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080720 IRAL001N08 pOTB7 BC000528 NM_002887 Full
HGY084131 IRAL010F11 pOTB7 BC014619 NM_002887 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR205446 ARiS013K06 pGCAP10 NM_002887.3  
GACTTGGCGAGTGAGACGCTGATGGGAGGATGGACATACTGGTGTCTGAGTGCTCCGCGC
HKR279392 ARiS198H24 pGCAP10 NM_002887.3  
NCCGNNNNCNCNCGGGCNCNNTNCGNNNCGCCCNNCGGCGAGNGAGNCGCNGANGGGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl